SGN Marker T1014

SGN-M1708
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TRXAX10TH
Arabidopsis best BAC match: AL021960.2
Arabidopsis position: 4.1090000
Arabidopsis identities: 0.857
Best GenBank protein hit: CAB79111.1
Evalue: 3.0e-75
Identities: 0.855
Description: G10-like protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49380)
Chromosome
11
Position
49.87 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47315)
Chromosome
11
Position
83.06 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39462)
Chromosome
11
Position
67.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1014 was used as an overgo probe on plate 3 [well D6]

Plausible BAC Matches:   P291G08,   P291G10,   P139J14,   P197P05

 Overgo Sequences

A sequence
GATCGGAGATACTTCCGTCCATAG
B sequence
GCATTTTCAGCTTCGGCTATGGAC
AB sequence
GATCGGAGATACTTCCGTCCATAGCCGAAG
Marker sequence
GCAGAAAACGGAGAAGCATACTTCCCGTAGTTGTAGCAGTAGCTTGCCGG
AGCCGGCGATCGGAGATACTTCCGTCCATAGCCGAAGCTGAAAATGCCTA
GAGTTAAGACAAACCGTATAAAATACCCTGAGGGTTGGGAGTTGATTGAG
CCTACGTTAGCTGAACTGGATGTTAAAATGAGAGAAGCTGGCAATGACTC
TAATGACGGTAAAAGAAAGTGTGAAGCACTCTGGCCCATATTCAAGGTTG
CACATCAGAGGAGCAGATATGTATATGACCTTTACTATGGAAGGAATGAA
ATATCTAAAGAGCTGTATGAATTCTGTTTGGAACAAGGTTATGCAGATCG
CAACTTGATTGCAAAGTGGAAAAAGCCTGGATACGAGCGTCTCTGCTGCT
TGCACTGCATACAGCCCCGGGATCACAACTTTGCGACTACTTGTGCGTGT
CGTGTCCCCAAACACCTCAGGGAAACTGCTGTAATTGAATGTGTACATTG
TGGATGTCAAGGTTGTGCAAGTGGTGACTAATTTGCTTTTCCAATAGCTG
TATGTTATGAGATCAGATGTTCTTACTGGCTTTTCAAAGCATTAGAAACC
TTTTGTCTGTAATGACC
Genomic location of T1014  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1708 marker 1708
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)