SGN Marker T1017

SGN-M1709
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRXBN43TH
Arabidopsis best BAC match: AC007519.2
Arabidopsis position: 1.0867000
Arabidopsis identities: 0.838
Best GenBank protein hit: AAD46042.1
Evalue: 4.4e-46
Identities: 0.560
Description: conceptual translation. [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39463)
Chromosome
3
Position
75.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1017 was used as an overgo probe on plate 8 [well E5]

Plausible BAC Matches:   P136B10,   P136J18,   P144B12,   P253J07,   P136J01,   P003A06

 Non-Plausible BAC matches

P299H10,   P324A01,   P257C01,   P002H14,   P324G09,   P252F22,   P316H13

 Overgo Sequences

A sequence
CTCCTACACTTTCCGAAGACGAAG
B sequence
ATGAGTTTGGCCCAGACTTCGTCT
AB sequence
CTCCTACACTTTCCGAAGACGAAGTCTGGG
Marker sequence
GACAATTTAAAAGATAGATATGACCACCTGAAGTTGGTCGTCCTTCCACA
GCCATGGAAAAGGGAGAAAGCTCTACTCCTACACTTTCCGAAGACGAAGT
CTGGGCCAAACTCATACCGACAGACTCTCGCTATTCAGAAATTGAGTTAA
GGTTGAAGGAGACCGTAATATGCAGTGAAGTAAAGCATTCTTCTTCTGAA
AAGCAAGATTGGTGTAAAATAACAAGGAATGTGGATCTAGATTCTGCCAT
GATGCAAAATAGAAGTTTGAAAGAAATTCTTGTTGATGAGACGGTTGTTC
AGGAAGAGCATGCTGCTGTAATTAAGTGTGGCAGTGAAATTTCACTAGGT
CCCAGTGATGAAGGTTATGTGAAATACCGATTCGAAATAATGCCTACTGA
GGAATCTCGCAGGTACATACAGATTTATCTCGATGTCGAGTATGCAAAAT
GCTGTATCTGCTTGAACATCTGGCATGATGTTGTCACAGCTGCACCTTGC
CTTCACAATTTCTGAGTGGTTAA
Genomic location of T1017  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1709 marker 1709
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)