SGN Marker TG328

SGN-M171

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
700
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TGTAGTATTCTAGTTAAACTACCTTTGAATGTCTAGTACCAGACTTATAATAGTATTTTGGTAGAATGTCTGCGTGTATATTTAGTTGGG
TGAATGGACTGGTGATCTGCTTATAGACTTGGGGAATCTTCCCCTCGACCCCTCACGAGCTAGCTTTTGGGGTTGCATATCATTGTCCAG
CTAACCAAACTAAACTATATGTATTTAAACCATATATGAAGTATACCTTATGGGAAATTTGAAGGAATGAAGGTTATTACTAGTATGTTA
AACTCATGCTTATGTAACTTTGAGCATTAACACATAAAAAGGGGCAGCGCGGTGCACTATATTCTCCGGCTATAACTAGGGACATTGAAC
TTGCATTTTTGCGAGAGACTATTTAAATGGCTAGAGACAAAGGCACGTTGCCATAATGGACATAAATTAACGACTATATACAAAGTTAGC
CATGTGTCACGA
Reverse sequence
TTTTTTTTATTTGTTGGAAAGAATTGGCTTTTGAATATCAAGAATTATTATCTTATTATTATTCCTCTCCATTTTTAATTAAATGGAGGG
GGTATCTAATAATGTTCATGGAGTTATATTAGCAATATCATCCAGTATTTTTATTGGTTCCAGCTTTGTTATTAAAAAACAAGGTCTAAA
GAAGGCTGGTGCAAATGGAAAAAGAGCAGGTTTATTCTTTTTCTCGCGCTATGATTCAAAAACTCGATGAATAATAGGCTTGCATCTTTC
TCCCCTTAAATACCAGACTTTTGTATTCAGAGAATCGTGACACATGGCTAACTTTGTATATAGTCGTTAATTTATGTCCATTATGGCAAC
GTGCCTTTGTCTCTAGCCATTTAAATAGTCTCTCGCAAAAATGCAAGTTCAATGTCCCTAGTTATAGCCGGAGAATATAGTGCACCGCGC
TGCCCCTTTTTATGTGTTAATG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1511383e-110204 (43.2% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53538)
Chromosome
9
Position
81.79 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2009

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50370)
Chromosome
9
Position
66.71 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48304)
Chromosome
9
Position
102.39 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43857)
Chromosome
9
Position
83.30 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43599)
Chromosome
9
Position
95.30 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43318)
Chromosome
9
Position
100.10 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42440)
Chromosome
9
Position
106.60 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40858)
Chromosome
9
Position
109.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36578
Forward primer (5'-3')
TGAATGGACTGGTGATCTGC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TTGGAAAGAATTGGCTTTTGA
Digested band sizes (using BstNI)
Solanum lycopersicum TA209
450
Solanum pennellii TA56
650
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39997)
Chromosome
9
Position
106.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8415)
Chromosome
9
Position
112.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8414)
Chromosome
9
Position
104.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8419)
Chromosome
9
Position
104.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG328 was used as an overgo probe on plate 14 [well H3]

Plausible BAC Matches:   P015O02,   P152J03

 Overgo Sequences

A sequence
CTCCGGCTATAACTAGGGACATTG
B sequence
CGCAAAAATGCAAGTTCAATGTCC
AB sequence
CTCCGGCTATAACTAGGGACATTGAACTTG
Marker sequence
TGTAGTATTCTAGTTAAACTACCTTTGAATGTCTAGTACCAGACTTATAA
TAGTATTTTGGTAGAATGTCTGCGTGTATATTTAGTTGGGTGAATGGACT
GGTGATCTGCTTATAGACTTGGGGAATCTTCCCCTCGACCCCTCACGAGC
TAGCTTTTGGGGTTGCATATCATTGTCCAGCTAACCAAACTAAACTATAT
GTATTTAAACCATATATGAAGTATACCTTATGGGAAATTTGAAGGAATGA
AGGTTATTACTAGTATGTTAAACTCATGCTTATGTAACTTTGAGCATTAA
CACATAAAAAGGGGCAGCGCGGTGCACTATATTCTCCGGCTATAACTAGG
GACATTGAACTTGCATTTTTGCGAGAGACTATTTAAATGGCTAGAGACAA
AGGCACGTTGCCATAATGGACATAAATTAACGACTATATACAAAGTTAGC
CATGTGTCACGA
Genomic location of TG328  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D171 marker 171
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)