SGN Marker T1038

SGN-M1716
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.13
Tomato EST read: TRXCA50TH
Arabidopsis best BAC match: AC007296.2
Arabidopsis position: 1.0360000
Arabidopsis identities: 0.681
Best GenBank protein hit: AAA81878.1
Evalue: 1.2e-88
Identities: 0.990
Description: clp-like energy-dependent protease [Lycopersicon esculentum]
Comment: "ATP-dependent Clp protease s located in the stroma, and is involved in the degradation of abnormal soluble and membrane-bound proteins"
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39465)
Chromosome
10
Position
33.70 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1038 was used as an overgo probe on plate 16 [well H8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCGGAGCATCAAAATGGTAACGTC
B sequence
CGTTCCAGCAATTGCAGACGTTAC
AB sequence
CCGGAGCATCAAAATGGTAACGTCTGCAAT
Marker sequence
GCTCTTCCTTCAGTTCTCAGTCACTGAACCCTCGCCGGAGCATCAAAATG
GTAACGTCTGCAATTGCTGGAACGTCAATTGTACCAGTCTCTTCCCGGCA
CCAAACGTCTTTTTCGTCTCTGCTTTCCTCTAGAAGCTTAAGGAAAAATG
TAGTTTCTGTTCTTCGAAGTCCATATTCTGATTCATCAGATATTGGATTT
TCAAGCAAGAAGTTGGGGATCCCATTAAAGTTCAATGAGTACGAATCCGG
TGCTCATACCAATTCAAGCTATGGTGTTATCGTAGCAAAAGAGGGGGCTA
ATCCGCCCATCATGCCCGCCGTGATGACACCAGTGGGCGCGTTGGATCTT
TCTACCGTGTTATTCAGGAATCGAATTATCTTCATTGGACAACCAGTCAA
CTCTGCAGTTGCTCAGAAAGTAATATCACAACTTGTGACCCTTGCAACTA
TAGATGAAAACGCAGATATTTTGATCTATCTTAACTGTCCTGGTGGAAGC
ACATACTCTGTCTTGGCAATATATGACTGCATGTCATGGATAAAGCCTAA
AGTTGGTACAGTATGTTTTGGAGCTGCTGCAAGCCAAGGAGCACTTCTTC
TTGCTGGTGGAGAAAAGGGCATGAGGTATGCAATGCCAAATGCACGTATA
ATGATTCATCAACCCTAAAATGGATGT
Genomic location of T1038  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1716 marker 1716
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)