SGN Marker T1039

SGN-M1717
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 8.07
Tomato EST read: TRXCA53TH
Arabidopsis best BAC match: AL080283.1
Arabidopsis position: 4.1600000
Arabidopsis identities: 0.881
Best GenBank protein hit: CAB79866.1
Evalue: 2e-110
Identities: 0.912
Description: putative protein [Arabidopsis thaliana]
Comment: 2.00E-76 match with emb|CAA40505.1| (X57228) beta COP [Rattus norvegicus]
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39466)
Chromosome
10
Position
62.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1039 was used as an overgo probe on plate 15 [well F7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CATCAAGGTGTCCTCAACTGAGAC
B sequence
CCCAAAAATGACGCCAGTCTCAGT
AB sequence
CATCAAGGTGTCCTCAACTGAGACTGGCGT
Marker sequence
GAGTCCAAGATGATTTGAAGCGTGCAACTGGAGAATTTGTCAAAGATGAG
ACAGATGCTAATAAACTTAACCGGGTTCTGCAACTAACAGGATTTAGCGA
CCCTGTTTATGCGGAAGCATATGTAACAGTTCATCATTATGATATTGTCC
TGGATGTGACAGTTATTAATAGAACTAAAGAGACCCTCCAGAATTTATGT
TTGGAATTGGCAACTATGGGTGATCTTAAACTTGTTGAGCGTCCACAGAA
TTATACTCTAGCTCCTGAGTCGAGCAAACAGATAAAAGCAAACATCAAGG
TGTCCTCAACTGAGACTGGCGTCATTTTTGGGAACATTGTTTATGAGACA
TCGAATGTGTTTGACCGGATGGTGGTTGTGCTAAATGACATTCATATTGA
CATCATGGATTATATATCCCCTGCAGTGTGCAGTGATGCTGCTTTTAGAA
CCATGTGGGCAGAATTTGAGTGGGAAAACAAGGTTGCTGTCAACACTGTC
ATTCAAGATGAAAAAGATTTTCTTGACCATATAATCAAATCAACCAACAT
GAAGTGCCTTACTGCGCTGTCTGCTTTGGAAGGGGAATGCGGGTTTCTCG
CTGCTAACTTGTATGCAAAGAGCGTGTTTGGCGAGGATGCTTTGGTGAAT
G
Genomic location of T1039  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1717 marker 1717
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)