SGN Marker TG183

SGN-M172

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TCTACTTGTCTGCCAAGGATTACTTAATTAATATAGCACAAGAATGCAAATTTACTCTTATTGAAAAATTGTATAGAGGTAAGCCTAATG
GATGAGATGAGGGAAGTCTTATTAGACAACTTCAGTTGATTGGGTATGTGAAGATTGCTATCAACATGTCTACTTAGATTTCACTAATGA
GGTGGACTATAACCATGTTCTCTCTAAAGAATTTGTGGAAATTGATAAATACCCTATGAAAATACTCAAGTGGATTGCGAATTTCAAACT
GGATGAGGAAACATCTATAGCCCCTGTGTGGATTCTAGTCCATCAATTACCATGGCATCTATTCAAGTGGCGTATCATCTCCAAATTAGT
AAGTCTTGTGGTAATGTTGCTAAAGTTAAGGTCAAAATAGATCTACTTAAACGAAGATCAGATAAAAATCTGGTTAGTATTTCATAGATT
GGATGGGTCTGAAGATGCTA
Reverse sequence
CAATCTGTGTTTAGTTTAAGCCAGCCACTATCTTGTTTTTGCCATAGAACCATCTTGATGTTATCACCTGCTTAGCTTATTCAATACTGC
TACAGAGTTCGTGCCGTTCAAGAAGAGTGTTAAAGATAGGAAAAAGACTGTTGAAGGACATATGCATTTTCTTGGTCACCTGTTTACTAA
TAAAGTTAGCAGATATCTTAGTATTATCAAATCTAGCACTATATCTACTAACTCTTCCAAATTCGCCAGCTAATTATAGTAGGCAAACAT
TGTATGAAAGCTTTGTGAATCTTATTCTTAGTTTTAGCAAGCCACAAGACAAAACGATTTTTCTAATGTTGCCAAATTTAAGAGGGACGC
CACAACTTGAACAAAAGTAAGACCAAACTTGATAAGCAATCTGACTACTACCAAAGAAATGCATAGTAGTTTCGTCTGCATGAGTATTGA
GGGGATAGGAACTTCCAGTTTTTTGAGAGCAACATCTGTATGA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53875)
Chromosome
7
Position
16.70 cM
Confidence
uncalculated
Protocol
RFLP

Eugenol_content_eug7_1
Tomato QTL map

Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53522)
Chromosome
7
Position
53.06 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50354)
Chromosome
7
Position
57.63 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48289)
Chromosome
7
Position
42.88 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43844)
Chromosome
7
Position
57.40 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43589)
Chromosome
7
Position
33.80 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43304)
Chromosome
7
Position
49.80 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40843)
Chromosome
7
Position
63.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39930)
Chromosome
7
Position
42.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8420)
Chromosome
7
Position
45.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8424)
Chromosome
7
Position
68.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG183 was used as an overgo probe on plate 9 [well E7]

Plausible BAC Matches:   P198J06,   P064M09,   P310D12,   P073G16,   P209B14,   P149K18,   P215D07

 Overgo Sequences

A sequence
GTATAGAGGTAAGCCTAATGGATG
B sequence
AAGACTTCCCTCATCTCATCCATT
AB sequence
GTATAGAGGTAAGCCTAATGGATGAGATGA
Marker sequence
TCTACTTGTCTGCCAAGGATTACTTAATTAATATAGCACAAGAATGCAAA
TTTACTCTTATTGAAAAATTGTATAGAGGTAAGCCTAATGGATGAGATGA
GGGAAGTCTTATTAGACAACTTCAGTTGATTGGGTATGTGAAGATTGCTA
TCAACATGTCTACTTAGATTTCACTAATGAGGTGGACTATAACCATGTTC
TCTCTAAAGAATTTGTGGAAATTGATAAATACCCTATGAAAATACTCAAG
TGGATTGCGAATTTCAAACTGGATGAGGAAACATCTATAGCCCCTGTGTG
GATTCTAGTCCATCAATTACCATGGCATCTATTCAAGTGGCGTATCATCT
CCAAATTAGTAAGTCTTGTGGTAATGTTGCTAAAGTTAAGGTCAAAATAG
ATCTACTTAAACGAAGATCAGATAAAAATCTGGTTAGTATTTCATAGATT
GGATGGGTCTGAAGATGCTA
Genomic location of TG183  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D172 marker 172
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)