SGN Marker T1044

SGN-M1720
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBAA01THB
Arabidopsis best BAC match: AC006068.3
Arabidopsis position: 2.1960000
Arabidopsis identities: 0.780
Best GenBank protein hit: AAD15447.1
Evalue: 6.7e-73
Identities: 0.514
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39467)
Chromosome
10
Position
34.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1044 was used as an overgo probe on plate 15 [well F8]

Plausible BAC Matches:   P308N11,   P192G18,   P251C20,   P150G16,   P023J05,   P171D18,   P243P17,   P324N12,   P183G12,   P237A02,   P271P22

 Overgo Sequences

A sequence
CGTGGACGTAGTACAACCATTGTC
B sequence
TGACCAGGTAGCAAAGGACAATGG
AB sequence
CGTGGACGTAGTACAACCATTGTCCTTTGC
Marker sequence
ATCCTACATTGCTGTATAATGTTGTGAGAAACAAGATTCAGACCGAGTTT
CGATGGTGGGATAGGGTTGATGAGTTCATACTGTTAGGAGCTGTTCCATT
TCCTACTGATGTCCCTCGCTTGAAGGCTCTAGGTGTTGCTGGAGTGGTCA
CGTTGAATGAATCATATGAGACTTTGGTCTCAACGTCATTATATCTTGAT
CATGACATCAATCACTTGGTGATTCCTACCAGAGACTATTTTTTTGCACC
ATCAGATGGAGATATTGACCGAGCTATAGAATTCATCCACAGTAATGCAT
CTTGTGGGAAGACAACGTACGTACACTGTAAGGCCGGCCGTGGACGTAGT
ACAACCATTGTCCTTTGCTACCTGGTCAAACACAAGGACATGACACCTGA
GGCTGCTTATGATTATGTCAGATCCATCAGACCAAGGGTGTTGTTGGCCC
CCTCTCAGTGGCAGGCTGTTCAAGAATACTACACAAGAGTAAAAAATACT
GATAATGATGTTTGTAGAGATGATAATTCATCGAAAATGCTTGACGTTCC
AGCTCAAAAAGAAGTTGCTGTCTTTGATGATGGCTCGGTTGTTCTAGTCT
CTGAATGTGACCTTGATGGATATGATGAAAGTGTTGAGTCAGATCTTACA
CGTAACGAAGTGTTAGTGGATTTAAACCTTGCATGTAGAGGAGTTCAAGT
TGCTCGCCAAGCAGCAATTTCTCGGCTTTCATACCTTTGGCTTCGCT
Genomic location of T1044  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1720 marker 1720
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)