SGN Marker T1046

SGN-M1722
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 10.01.01.11
Tomato EST read: TFBAA11TH
Arabidopsis best BAC match: AC005623.2
Arabidopsis position: 2.1520000
Arabidopsis identities: 0.714
Best GenBank protein hit: CAA73067.1
Evalue: 4.3e-66
Identities: 0.836
Description: serine/threonine kinase [Sorghum bicolor]
Comment: yeast SNF1 protein like kinase
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39469)
Chromosome
11
Position
54.70 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1046 was used as an overgo probe on plate 1 [well D8]

Plausible BAC Matches:   P211L15,   P029C01,   P162B15,   P077H01,   P119E13,   P316D24,   P077F16,   P251I24,   P213C11,   P251I23

 Overgo Sequences

A sequence
GCCACTGAGGTATTTCAAGTTGCC
B sequence
CCATATGAAGAGAAGGGGCAACTT
AB sequence
GCCACTGAGGTATTTCAAGTTGCCCCTTCT
Marker sequence
GATGTTGAAGCTGTCTTCAAGGATTCTGAAGAACATCATGTAACAGAGAA
AAAGGAAGAGCAGCCAACTCCCATGAATGCATTCGAGTTGATTTCAATGT
CAAAAGGACTCAACCTTGGGAATCTCTTCGATGAACAGGAATTTAAGAGA
GAAACAAGGTTCACATCTAAATGCTCGGCCAATGAAATTATCAGTAAGAT
TGAAGAAGCTGCAAAGCCCCTCGGTTTTGATGTTCACAAAAAGAACTACA
AGATGAGACTTGAAAATGTCAAAGCTGGAAGAAAAGGGAACCTTAATGTT
GCCACTGAGGTATTTCAAGTTGCCCCTTCTCTTCATATGGTTGAAGTCCG
AAAGGCAAAAGGAGATACTTTGGAATTCCACAAGTTCTACAAGAATCTTT
CGACTAGTCTAGAGGATGTAGTGTGGAAAACTGAAGAGGACATGCAAGCT
AAGTAGTATTACTACCATGAACTGCAATTGCATAAGCTTTTGCTGGTCCC
ACAATCTGTGTAAAAAACTTTGCAACTTGGTTCTTTCTTTCCC
Genomic location of T1046  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1722 marker 1722
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)