SGN Marker T1048

SGN-M1724
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBAA15THB
Arabidopsis best BAC match: AC005275.1
Arabidopsis position: 4.0190000
Arabidopsis identities: 0.729
Best GenBank protein hit: AAD11582.1
Evalue: 3.9e-78
Identities: 0.688
Description: GH3-like protein [Arabidopsis thaliana]
Comment: GH3 is cotton lipid transfer protein
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39472)
Chromosome
10
Position
20.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1048 was used as an overgo probe on plate 16 [well B6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTCGGCGGATTCTTGAACTCAACC
B sequence
AGGTACTCAACACCATGGTTGAGT
AB sequence
TTCGGCGGATTCTTGAACTCAACCATGGTG
Marker sequence
GACTAGATAAGTCCAATTATTACACTGACACTGATGAAATGATCAATTGG
TTCGAAAAATCCGCCGAAAATGCTGCCGCTGTACAGCGGCAGACGCTTCG
GCGGATTCTTGAACTCAACCATGGTGTTGAGTACCTAAAAAAATGGCTTG
GAGATATTAGACTTCAAGATGAAAATGCTATGGAATCACTTTATGCTACT
ATGGTTCCTCTTGCTTCTCATGCAGATTTTGAGCCTTATATACATAGAAT
TGCTGATGGTGAAAAAGCTCCTTTACTCACTCAAGACCCTATGAGAACTT
TGTCCTTAAGTTCTGGAACCACAGAGGGAAGACAGAAATTTGTACCATTT
ACTCATCATAGCTCCCAAACAACTCTTCAAATTTTCAAATTGGCAGCAGC
TTATAGATCAAGGATTTATTCAATAAGAGAAGGTGGAAAAGTTCTTGAAT
TTATATATAGTAGCAAACAAACCAAAACAAAAGGGGGATTAATAGCAGGA
ACAGCCACAACACATTATTATGCTAGTGAAGAATTCAAGATTAAACAACA
ACACACAAAGTCTTTTACTTGTAGCCCTGAGGAAGTTATTTCAAGTGGAG
ATTATAAACAATCAACATATTGGCATCTACTT
Genomic location of T1048  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1724 marker 1724
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)