SGN Marker T1049

SGN-M1725
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 4.05.01.04
Tomato EST read: TFBAA21THB
Arabidopsis best BAC match: AB025629.1
Arabidopsis position: 3.0600000
Arabidopsis identities: 0.767
Best GenBank protein hit: BAA74714.1
Evalue: 2e-109
Identities: 0.777
Description: transcription factor TEIL [Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49381)
Chromosome
6
Position
41.87 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47316)
Chromosome
6
Position
76.09 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39473)
Chromosome
6
Position
72.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1049 was used as an overgo probe on plate 4 [well F3]

Plausible BAC Matches:   P305E13,   P170J22,   P304K18,   P263J06,   P233A10,   P032F01,   P271F05

 Overgo Sequences

A sequence
AGGCAGTCAAAGTGCTTACAGGAC
B sequence
CCTTGGCTGTCATCTTGTCCTGTA
AB sequence
AGGCAGTCAAAGTGCTTACAGGACAAGATG
Marker sequence
GCTGAAGAAGGCGTGGATGGTTGGTGTCCTAACAGCGGTGATCAAGCACA
TGTTCCCTGATATTGCTAAAATCCGCAAGCTGGTAAGGCAGTCAAAGTGC
TTACAGGACAAGATGACAGCCAAGGAAAGTGCAACTTGGCTTGCCATCAT
CAGTCAGGAGGAAGCTTTGGCTCGAGAACTCTATCCCGATCGCTGTCCAC
CTTTGTCCTCAGCTGGTGTTAGTGGAAATTTCATGTTGAACGACAGCAGT
GAGTATGATGTTGAAGGTGCTCAAGATGAGCCTAACTTTGATGTTCATGA
GCAAAAACCAAACCATCTCAATCTGTTGAACATCAGTGCTGAGAGATTCA
AGGAGACGATGCCTCTTCAGCAACAATCTCATCCAAACAAGGATGAACTG
GTCACAAACTTAGACTTCAGTCTGAAGAGGAAGCAAGCTAATGAACCTAC
TGTGATGATGGATCAAAAGATATACACATGCGAGTTTCTTCAATGCCCTC
ACAATGAACTTCGCCATGGTTTTCAGGACAGATCTTCCAGAGACAATCAT
CAATTTGCTTGCCTTTACCGAAGTTCTACCTGTTTTGGAGTTTCAAACTT
TCAGATTAATGAAGTCAAGCCAGTTGTGTTCCCTCAACAATATGTCCAGC
CAAAGTCATCTGCTCTGCCTGTTAATCAAAGTCCACCTTCCTTTGATCTA
TCTGGTATAGGAAGTTCCTGAAGATGGGCAAAGGATGATTAATGAGCTTA
TGTCAATCTATGATAGTGATGTACAAGGAAGC
Genomic location of T1049  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1725 marker 1725
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)