SGN Marker T1050

SGN-M1726
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBAA25THC
Arabidopsis best BAC match: AC010871.5
Arabidopsis position: 3.0123000
Arabidopsis identities: 0.323
Best GenBank protein hit: CAB82273.1
Evalue: 1.6e-14
Identities: 0.375
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49382)
Chromosome
4
Position
56.80 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47317)
Chromosome
4
Position
58.33 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39474)
Chromosome
4
Position
74.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1050 was used as an overgo probe on plate 1 [well B3]

Plausible BAC Matches:   P153F12,   P066O12

 Overgo Sequences

A sequence
CGGAGGGAGAAAAAAGCCCTAAAC
B sequence
ACCTCTCCAGACCAAAGTTTAGGG
AB sequence
CGGAGGGAGAAAAAAGCCCTAAACTTTGGT
Marker sequence
CTGTGAACTCCGCTAATCATTCTTCTTTTCAAATTACTACATTCGGAGGG
AGAAAAAAGCCCTAAACTTTGGTCTGGAGAGGTCGAAAATGGTGGATGGG
TCGAATAACGTGGATGTAGAGAAGCTGATCTCCTTCAGTAAGGATCTTGT
TCAGTTTTTGAAAGAAGATAAAGATGTCAGCTTCTTGAATCAGTGTAAAG
AGCAATTTAATGCCCTTCAATCACACTGCCAATCTGAGTACCAGGCTCTT
CAGAATTCCATTCAAGATTATCAAGGAAAGATAAATGCATGTAAGCAGAG
AACAACAGAAGCACAATCTGAAGCTGCTGCAGAGGCTGAAATAGATAAGC
TGCAGAAAGAGTTAGAACAGGAGATCCAGAGAGAACAACTGCTTAGAGAA
GAACTTAGAGTTATAACCGATGAGATCAATGATTTAGATCGCCAAAGAGA
CTCTATTGAGGAGCACAGGAAATTGCTCAAGAAAATTGAGCAAGATCATC
TTCGAGCTGAGATGAAGCTATCACTGTATGCTTCTGTCACAAGTATCATC
CCGGACTTGGATGATCAATCCAAAATATCAGGCCATATTGTGGAGAGAGA
TAAGAAGGTGGTTGAAAATTTCGAGTTTGATTCATCAAATCAAACTGCCT
TTGACACTTGTAACAACATCTGGAAGATGATTAATTT
Genomic location of T1050  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1726 marker 1726
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)