SGN Marker T1051

SGN-M1727
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBAA28THC
Arabidopsis best BAC match: AB010076.1
Arabidopsis position: 5.2840000
Arabidopsis identities: 0.733
Best GenBank protein hit: BAB11434.1
Evalue: 2.4e-52
Identities: 0.698
Description: similar to unknown [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39475)
Chromosome
2
Position
75.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1051 was used as an overgo probe on plate 1 [well D11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CATCTCCAGCATTGGATCATTGGG
B sequence
TCTGCGAAACTGACACCCCAATGA
AB sequence
CATCTCCAGCATTGGATCATTGGGGTGTCA
Marker sequence
GATTACATTGCTCAACTATAAACCCTAGAAGAAATGTTGAGAAGAAGAAT
CACTTCACTACTATCATCGTCTTCACTCCAAAATGTTCCAATCTACGGCG
AACCCATCAAGATTTCTCAACCCATATTCACATCTTCACAAAAGTTACCA
CTTTTGCAATTCTCTCAACGCCCCATCTCCAGCATTGGATCATTGGGGTG
TCAGTTTCGCAGAGCTTACAGTCTTCTGAGCCTAAATGATTTGCAAGATA
ACAAAGGTGCTAGGAAGCAGAAGACTCGGAAGGGAAGAGGTATTGGGTCT
GGTAAAGGGAAGACGGCGGGTCGTGGACATAAGGGTCAGAAAGCTAGAGG
GACGTATAAGTTCGGGTTTGAAGGTGGACAGACCCCACTTCGTCGCCGTG
TGCCTAAACGTGGATTTAAGAACCCGTTCAGTCTCACATTTCAGCCAGTT
GGGTTGGGAAAGATTGCAAATCTGATAAATGCTGGGAAGATTGACTCGTC
AGAGTTGATCACAATGAAAACTCTAAAGGATTCCGGTGCAATAGGGAAGC
AAATAGAAGATGGAGCCAGGTTGATGGGGCGTGGGGCTGAACTTATTCAA
TGGCCCATCCATCTAGAGGTTTCAAGGGTGACCGCTAGAGCTAAAGCAGC
TGTGGAAGCAGCGGGTGGGTCTGT
Genomic location of T1051  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1727 marker 1727
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)