SGN Marker T1053

SGN-M1729
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 8.07
Tomato EST read: TFBAA41THB
Arabidopsis best BAC match: AC004809.1
Arabidopsis position: 1.0110000
Arabidopsis identities: 0.865
Best GenBank protein hit: AAC04496.1
Evalue: 3e-100
Identities: 0.865
Description: putative synaptobrevin [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 43008)
Chromosome
6
Position
53.60 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 44008
Forward primer (5'-3')
CGCGAGGAACGGTGATT
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GCAACCACATCTTCCTCCTCAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39476)
Chromosome
6
Position
98.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 13970
Forward primer (5'-3')
AACGGTGATTCTCGCTGAGT
Digested band sizes (using HinfI)
Solanum pennellii LA716: 950
Solanum lycopersicum LA925: 1100
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GCAACCACATCTTCCTCCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1800
Solanum lycopersicum LA925: 1800
Approximate temperature
55°C
  
PCR data   Exp. ID 13970
Forward primer (5'-3')
AACGGTGATTCTCGCTGAGT
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 1100
Solanum pennellii LA716: 950
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GCAACCACATCTTCCTCCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1800
Solanum lycopersicum LA925: 1800
Approximate temperature
55°C
  
PCR data   Exp. ID 14120
Forward primer (5'-3')
AACGGTGATTCTCGCTGAGT
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GCAACCACATCTTCCTCCTC
Enzymes
  
Accessions and product sizes
Approximate temperature
55°C
  
PCR data   Exp. ID 84
Forward primer (5'-3')
Unknown
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 1100
Solanum pennellii LA716: 950
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1800
Solanum lycopersicum LA925: 1800
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T1053 was used as an overgo probe on plate 2 [well B12]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GCTACAGCTGTTGCTAACAGCTTG
B sequence
GCCCAAACTCCTTGTTCAAGCTGT
AB sequence
GCTACAGCTGTTGCTAACAGCTTGAACAAG
Marker sequence
GTCTTTTCTCGAGTGTGTGAGAAGAGAGAGGAAAAATGGGGCAACAATCG
TTGATCTACAGCTTCGTTGCGCGAGGAACGGTGATTCTCGCTGAGTATAC
TGAGTTCACTGGAAATTTTACCAGTATTGCATCGCAGTGCCTTCAGAAAC
TCCCTGCTTCCAACAACAAGTTCACCTATAACTGTGATGGACATACTTTT
AACTACCTCGTCGATGACGGCTTCACATACTGTGTTGTAGCTGTGGAGTC
TGTTGGCAGACAGGTCCCAATCGCATTTCTGGAGAGAGTTAAGGATGATT
TTACCAAGAAATATGGTGGAGGCAAAGCTGCTACAGCTGTTGCTAACAGC
TTGAACAAGGAGTTTGGGCCCAAAATAAAGGAGCAGATGCAGTACTGTGT
TGATCATCCAGAGGAAATCAACAAGCTTGCAAAGGTGAAGGCTCAGGTTT
CGGAAGTTAAAGGTGTGATGATGGAAAACATTGAGAAGGTCCTGGATCGT
GGGGAGAAAATTGAACTTTTGGTGGATAAAACTGAGAACCTTCGTTCACA
GGCACAAGATTTCAAGACACAAGGAACAAAAGTGAGGAGGAAGATGTGGT
TGCAGAACATGAAGATAAAGCTTATAGTCCTGGGCATCA
Genomic location of T1053  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1729 marker 1729
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)