SGN Marker TG351

SGN-M173

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CAGGAACTCTTTATTCATTCACAACATCACCAGCCACAAGCACACCTGGTGTCTCACAGACTCCATAAACAATCACAAACTCAATAGTGT
TTCATCACACTGGGTATAACTAGGCAAAACACGTCCAAATAAAGATCAATAGACAGAAACAGGAACACAGGACAAGGATTGATAAGTAAT
AGTAATAAAATAAACTGCAAAAGAGCGAACGAGTAAATGGTAAAATTGGTTTTCATACTCGACGAAATCATGAAATACTAGTTCACATAA
GTAGCAACTATATCCCCATAACAAACAAAATTGAAAACCCAAAGGTTGGGATAACAGTAACAGCGATAAACAGAAATCCAGAAAGCCCCT
ATTGCTCTAAGCTTAAGTCTATTCTTCTGCGGCAGTTTCACCGTTCTTCTTGTTGTGCTTCCTAGCATACCTCTGGTTCCTCAAGAA
Reverse sequence
TTTGATTGTGAGATCGAAGATCAGAAATGGCCAAGTCGAAGAATCATACCGCACACAATCAGTCCTACAAGGCTCACAGGAACGGAATCA
AGAAGCCAAAGAGTCACCGTCACAGCTCCACCAAAGGGGTATGTTGAAAAAAACGTACTTTTTTGTACTTACCGATGTTTGCTTATTATG
ATATTTTTGCCGTTCATATCAGTTTGTTTTACAGCTTTAGCTCTAGGTTATCAATGGGTTTATAGAAAAATGAGTTTATTATTGTTCTGT
TTAGTTACATTGTAGATTTAGAAGTTGAATCTTAAAAAGTGAAAAACTGAGCTGATAATGTGTTGATTTTGGATTTTGAAGTTATGCTTA
AGCATAAATTTTACTTGGAAAAAAGTTTGAACTTTCTGAGTAGAAGCCCCAAACAGCATATACTTGCTGAAAATATTTGAAAATCAGGTC
AAATTTCAAGGCCAAAC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1472161.3e-1033 (7.4% of RFLP seq)+
SGN-U1467171e-121237 (53.0% of RFLP seq)+
SGN-U1472161e-20106 (22.7% of RFLP seq)-
SGN-U1467172.8e-67128 (27.4% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53542)
Chromosome
5
Position
72.24 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53280)
Chromosome
5
Position
43.96 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42446)
Chromosome
5
Position
30.40 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40008)
Chromosome
5
Position
102.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8426)
Chromosome
5
Position
31.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8425)
Chromosome
5
Position
72.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8430)
Chromosome
5
Position
40.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8429)
Chromosome
5
Position
94.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG351 was used as an overgo probe on plate 5 [well E8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AACATCACCAGCCACAAGCACACC
B sequence
AGTCTGTGAGACACCAGGTGTGCT
AB sequence
AACATCACCAGCCACAAGCACACCTGGTGT
Marker sequence
CAGGAACTCTTTATTCATTCACAACATCACCAGCCACAAGCACACCTGGT
GTCTCACAGACTCCATAAACAATCACAAACTCAATAGTGTTTCATCACAC
TGGGTATAACTAGGCAAAACACGTCCAAATAAAGATCAATAGACAGAAAC
AGGAACACAGGACAAGGATTGATAAGTAATAGTAATAAAATAAACTGCAA
AAGAGCGAACGAGTAAATGGTAAAATTGGTTTTCATACTCGACGAAATCA
TGAAATACTAGTTCACATAAGTAGCAACTATATCCCCATAACAAACAAAA
TTGAAAACCCAAAGGTTGGGATAACAGTAACAGCGATAAACAGAAATCCA
GAAAGCCCCTATTGCTCTAAGCTTAAGTCTATTCTTCTGCGGCAGTTTCA
CCGTTCTTCTTGTTGTGCTTCCTAGCATACCTCTGGTTCCTCAAGAA
Genomic location of TG351  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D173 marker 173
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)