SGN Marker T1063

SGN-M1734
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBAN19TH
Arabidopsis best BAC match: AL021636.3
Arabidopsis position: 4.1630000
Arabidopsis identities: 0.793
Best GenBank protein hit: CAB79924.1
Evalue: 5.4e-36
Identities: 0.788
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39479)
Chromosome
6
Position
12.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1063 was used as an overgo probe on plate 4 [well B5]

Plausible BAC Matches:   P009H10,   P286O16,   P205L01,   P265E13,   P113K13,   P216M17,   P191D05,   P157P07,   P288A21,   P138F10,   P235K16,   P030K12,   P336A18,   P059C22,   P029I22,   P120F05,   P056G06,   P052B21,   P242H19,   P031D22,   P164K01,   P154O22,   P196C10,   P125H08,   P331B11

 Overgo Sequences

A sequence
GTACACCATCGATCACAACCCAAC
B sequence
TGGCTAAAATGGCGGAGTTGGGTT
AB sequence
GTACACCATCGATCACAACCCAACTCCGCC
Marker sequence
GGTCTGGTTTTGAAGTAAAGTATGCCATCTTGGTCGGATCTCCGGCGATG
TACACCATCGATCACAACCCAACTCCGCCATTTTAGCCATTTAAGTAGAA
CTGATGGTCAGCAGGATCCAAAAAGTAGTTCAATATCTTTCCTCAAATGG
ATTGGTGGAATCATTACCAGTTCCACTTTAGCTTTCGCATATTACTCCTA
TAACTATTCTTCACCAAATTACCCATCTTTCTCTTTTTCCCACACATCAC
AATCTCGACCAAGCTATCTCTTTGGAGATGCTTACAGAAGAAAAGTATTC
TTTAATTATGAAAAGCGTATTAGGATGCGAAGTCCTCCTGAAAAGGTGTT
TGAGTACTTTGCATCTTTTGAAGCCCATGATGGAGAAATATTTATGACAC
CAGCAGATCTAATGAGAGCAGTTGTTCCGGTGTTCCCTCCATCTGAATCA
CACCTCGTGAGAGATGGATATCTCAGAGGTGAAAGAAATCCGGGTGAATT
GCGATGTGCCCCATCAAAA
Genomic location of T1063  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1734 marker 1734
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)