SGN Marker T1065

SGN-M1736
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 11.05.03
Tomato EST read: TFBAN38TH
Arabidopsis best BAC match: AB026636.1
Arabidopsis position: 3.0410000
Arabidopsis identities: 0.642
Best GenBank protein hit: BAA94976.1
Evalue: 5.7e-71
Identities: 0.659
Description: basic chitinase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49383)
Chromosome
9
Position
67.61 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47318)
Chromosome
9
Position
108.90 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-LXCHM 2007   
Map version
68 (location: 43009)
Chromosome
9
Position
90.80 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 44009
Forward primer (5'-3')
ATCATTGGGGGTTTTGTTCAT
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
GTAGTTCCAGTAGATAGGCAAGGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Eggplant-COSII   
Map version
63 (location: 42381)
Chromosome
9
Position
112.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43842
Forward primer (5'-3')
GACGGTGAAGGGTACCAAGA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CAGGAGTGCATGGGTAGGTT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39481)
Chromosome
9
Position
116.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35598
Forward primer (5'-3')
GACGGTGAAGGGTACCAAGA
Digested band sizes (using Tsp509I)
Solanum pennellii LA716: 350
Solanum lycopersicum LA925: 200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CAGGAGTGCATGGGTAGGTT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 407
Solanum lycopersicum LA925: 407
Approximate temperature
55°C
  
PCR data   Exp. ID 121
Forward primer (5'-3')
Unknown
Digested band sizes (using Tsp509I)
Solanum lycopersicum LA925: 200
Solanum pennellii LA716: 350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 407
Solanum lycopersicum LA925: 407
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T1065 was used as an overgo probe on plate 14 [well A11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTCAGGAAGCAACCCACACTAGTG
B sequence
TACCCTTCACCGTCTTCACTAGTG
AB sequence
TTCAGGAAGCAACCCACACTAGTGAAGACG
Marker sequence
GATTCATTCTCTCTTCTATTCTATTCACTTTCTACTAAGAAAATGAAGAT
GAGGATGATTATGATTTTGTTTCTGTTGGTAATCATTGGGGGTTTTGTTC
ATGGAGATGAGAATGAGTCATTCAGGAAGCAACCCACACTAGTGAAGACG
GTGAAGGGTACCAAGATGTGTGTGAAGGATTGGGAGTGCAACAAATTGTC
TAAATTTTGTTGTAATTTGACAATTACTGATTATCTGGATGTTGACCAAT
TTGAGCTCCTTTTCACTAAGAGGAACTCACCCGTAGCTCATGCTGTTGGA
TTCTGGGATTATGGATCTTTCATTAGGGCTGCAGCACTTTACCAGCCTCT
TGGATTTGGTACCACCGGTGGTAAGAAAATGCAGATGAAGGAGATTGCTG
CTTTTTTTGGACATGTCGGTAGCAAAACTTCTTGTGGTTATGGTGTCGCC
ACTGGCGGACCACTCGCTTATGGTCTATGCTATAACAAAGAAATGAGTCC
CAGCCAAGATTACTGTGATGAATACTTCAAATTAACCTACCCATGCACTC
CTGGAGCCAGATATTACAGTCGTGGTGCCTTGCCTATCTACTGGAACTAC
AATTATGGAGCTAT
Genomic location of T1065  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1736 marker 1736
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)