SGN Marker T1066

SGN-M1737
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.07.01
Tomato EST read: TFBAN39TH
Arabidopsis best BAC match: AC002335.2
Arabidopsis position: 2.2360000
Arabidopsis identities: 0.866
Best GenBank protein hit: AAB64312.1
Evalue: 2.4e-59
Identities: 0.881
Description: biotin synthase (Bio B) [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39482)
Chromosome
6
Position
69.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1066 was used as an overgo probe on plate 5 [well B1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTGTCAGCTTCAGCAGCTGCAGTA
B sequence
TACATCGTTCCGCTTCTACTGCAG
AB sequence
TTGTCAGCTTCAGCAGCTGCAGTAGAAGCG
Marker sequence
GGCAAATAGCAATTGAAAGCTGCTCTGTTTTGCTTCACCTATCTGCTTCT
GCAAATCCGGCCATTTCTGTGTATATATATAGATAGAAGGTGAAAAGGAT
GATGTGGGTTCGATCGATTCGGCGGCCATTATCGTCGTTGGTTCTACTTC
AGTCGCGTGNNNNGAATTATTCCTCATTGTCAGCTTCAGCAGCTGCAGTA
GAAGCGGAACGATGTATAAAGGAAGGACCCAGAAATAACTGGACTAGAGA
TGAAATCAAGTCTATTTACGATTCACCACTCCTCGATCTCCTCTTTCATG
GCGCTCAAGTACATAGACATTCTCATAACTTTAGAGAAGTACAGCAGTGC
ACTTTGCTGTCTATTAAGACAGNNNNATGCAGTGAAGATTGTTCGTATTG
TCCTCAATCGTCTAGGTACAACACAGGACTGAAAGCACAGAAACTTATGA
ATAAGGATGCAGTCTTGGAAGCAGCACGAAAGGCGAAAGAGGGAGGTAGC
ACTCGTTTTTGTATGGGTGCTGCATGGAGGGATACAATAGGAAGGAAAAC
CAAT
Genomic location of T1066  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1737 marker 1737
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)