SGN Marker TG184

SGN-M174

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1220
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG184 image not available
Forward sequence
AAGTTAAAAAATCCAGTTTACACCATCAACAACCAACATTTAGAACTTCTTCATGTGGTAAGTCGCTCTTTGGATTTTCTTTTGTTGGGA
TAACGAGTCCAAATAATAAAGGAAATTCAGATTGTAAAAAATAAATAAATAAAAGCACACAACAATTATATAAATTACAGAGAATCAGAA
AGTTGTAAAGTATGGGACAAACTTTTGCTTGAACTGAAGGGAAGTCAAAAAGACCAATCTATCACAGGCACATGGGGGAATATAATGATC
TTGAAGATTCAAAATCTTTTTACAACCCAAAAACAGATAACCATTACACGCATTGCTCTCTTCCAAACAGTTTTTCCCTCCTCCCAAAAT
ACAATTATGTTTCACTTGCTCTTCTCCTTCTTCATCCCCCTACCCCCA
Reverse sequence
ATGATGATTTGTCATGCCCGAGCTTACAAAAGTAACTCAGAACATTGTCAAACTTTTACTTGTTAGACTGGTCATGCTCTAGCTTACACA
AGTAACTCAGAACATTATCAAACTTCTACTTGCTAGACTGGACTTTTAGGTTAAATGAAGGGCAGGTTTTTTATGTTTGCCCCATCTCTT
TTGGATCCAATATTGGAAGAACAGTTTGTTGTTAGCAGATAATTAGAAGGATGCTTATCATGACCATGATAACATTTGAATAATTAATTG
ATGGGATCAGACATCGTAGAACATAAAGATCCGGTGGTCTTTGACCTACTAAGTATTTGTACACGATGGTAGAACTACTTGTTCCTTGAA
TGGAAGGATGACGAGAGCACAATTCAATCCAAAC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39931)
Chromosome
1
Position
20.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8431)
Chromosome
1
Position
8.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Other PCR data 
PCR data   Exp. ID 35617
Forward primer (5'-3')
TTGTTGGGATAACGAGTCCA
Digested band sizes (using AluI)
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATTTGTCATGCCCGAGCTTA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 3
Forward primer (5'-3')
Unknown
Digested band sizes (using AluI)
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG184 was used as an overgo probe on plate 3 [well D3]

Plausible BAC Matches:   P032K21,   P291L11

 Overgo Sequences

A sequence
CACGCATTGCTCTCTTCCAAACAG
B sequence
TGGGAGGAGGGAAAAACTGTTTGG
AB sequence
CACGCATTGCTCTCTTCCAAACAGTTTTTC
Marker sequence
AAGTTAAAAAATCCAGTTTACACCATCAACAACCAACATTTAGAACTTCT
TCATGTGGTAAGTCGCTCTTTGGATTTTCTTTTGTTGGGATAACGAGTCC
AAATAATAAAGGAAATTCAGATTGTAAAAAATAAATAAATAAAAGCACAC
AACAATTATATAAATTACAGAGAATCAGAAAGTTGTAAAGTATGGGACAA
ACTTTTGCTTGAACTGAAGGGAAGTCAAAAAGACCAATCTATCACAGGCA
CATGGGGGAATATAATGATCTTGAAGATTCAAAATCTTTTTACAACCCAA
AAACAGATAACCATTACACGCATTGCTCTCTTCCAAACAGTTTTTCCCTC
CTCCCAAAATACAATTATGTTTCACTTGCTCTTCTCCTTCTTCATCCCCC
TACCCCCA
Genomic location of TG184  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D174 marker 174
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)