SGN Marker T1079

SGN-M1748
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.07
Tomato EST read: TFBAT16TH
Arabidopsis best BAC match: AB016884.1
Arabidopsis position: 5.0470000
Arabidopsis identities: 0.647
Best GenBank protein hit: BAB11233.1
Evalue: 3.3e-69
Identities: 0.658
Description: 6-phosphogluconolactonase-like protein [Arabidopsis
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49386)
Chromosome
6
Position
32.44 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47321)
Chromosome
6
Position
33.03 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39490)
Chromosome
6
Position
27.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1079 was used as an overgo probe on plate 2 [well F11]

Plausible BAC Matches:   P222I23,   P152K04

 Overgo Sequences

A sequence
GGCTAAAATGGCAACCCAGAAAGG
B sequence
TAGCACCGTCTTCTTCCCTTTCTG
AB sequence
GGCTAAAATGGCAACCCAGAAAGGGAAGAA
Marker sequence
GAAATAGCTTCAGATTTAGGCTAAAATGGCAACCCAGAAAGGGAAGAAGA
CGGTGCTAAAATTCGACTCCGAAGAAGATGTATCAAAGGCACTTGCTAAA
TACACTGCTGAGCTATCGGAAAAATTCATCAAACAAAAAGGTTCTTTCAC
TGTTGTGCTCTCTGGTGGTTCTCTTATCGATACCATGAGGAAATTGGTAG
AGCCGCCGTACAAAGACTCAATTGATTGGTCGAAATGGTGGATTTTTTGG
GTAGACGAAAGAGTGGTTCCTCTAGGTCACGATGATAGCAATTATAAACT
TGCTTCGGATGGGTTTCTTTCTAAGGTTCCGATCCCCTCTTCTAACATTT
ATGCGATTAATGACAAGGAGTCACCTGAGGGTGCAGCTGCTGATTACGAA
GCTCGTCTGAAACAATTGATTGAGAGCAAAGTTCTTCCGTTATCAGCAAT
TACTGGATTCCCCAAATTTGATCTTATGCTATTAGGTATGGGGCCAGATG
GACATGTAGCGTCTTTGTTTCCTTTGCATCCTCACCGCCACGAGAAGGAG
CGGCTGGTCACCTTCATTACAGACTCACCAAAACCTCCTCCACCAAGGAT
TACTTTCACCTTTCCGGTAATTAATTCGGCTT
Genomic location of T1079  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1748 marker 1748
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)