SGN Marker T1082

SGN-M1749
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.01
Tomato EST read: TFBAT44TH
Arabidopsis best BAC match: AC007727.2
Arabidopsis position: 1.0460000
Arabidopsis identities: 0.527
Best GenBank protein hit: AAD28260.1
Evalue: 1.4e-62
Identities: 0.594
Description: protein disulfide isomerase homolog; PDI [Datisca glomerata]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49387)
Chromosome
6
Position
0.92 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47322)
Chromosome
6
Position
1.62 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39491)
Chromosome
6
Position
3.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1082 was used as an overgo probe on plate 1 [well G12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCTTTCTCTTGGGTGATGTTGACG
B sequence
AAAGCACCTTGACCAGCGTCAACA
AB sequence
GCTTTCTCTTGGGTGATGTTGACGCTGGTC
Marker sequence
GCACAAACCTTATTGATGAGAAAAGTATCTTTGTTGGTGGTATATTTCCA
GACCCCTCCGGAGAGAAATTCGAGAACTATTTAACGCTAGCTGAAAAACT
GCGAGGCGAGTTCGATTTTGCTCACACTGTTGATGCTAAACACCTCCCTC
GGGGTGGACCAGTCAACAAGCCCACTCTTCGTCTTCTAAAGCCATTTGAT
GAACTCTTTGTTGATTTTGAGGACTTTGATGTCGATGCAATGGAGAAGTT
CATCTCAGAATCTAGTATTCCTGTTGTTACTATTTTTGACAATGACCCAA
ACAACCATCCTTATGTTAACAAGTTCTTCGAAGGCACCAACGCCAAGGCA
TTGCTATTTGTGAACTTTAGCTCTGAATTTGATGCTTTTAAGTCCAAGTA
CAACGATGTTGCTGTGATTTACAAAGGGGATGGGGTGAGCTTTCTCTTGG
GTGATGTTGACGCTGGTCAAGGTGCTTTTGAGTACTTCGGACTGAAGCCG
GAACAGGCACCTGTGATCATCATAATGGACGCTGATGAACAAAAGTATAT
TAAGGACCATGTGGAACCTGATGCCATTGCTGCTTACTTGAAGGATTACA
AGGAAAGAAAACTGAAGCCACATGTGAAGTCAGAGCCCATCCCTGAAG
Genomic location of T1082  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1749 marker 1749
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)