SGN Marker T1086

SGN-M1751
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBAT58TH
Arabidopsis best BAC match: AC007584.3
Arabidopsis position: 2.1020000
Arabidopsis identities: 0.614
Best GenBank protein hit: AAD32914.1
Evalue: 6.5e-46
Identities: 0.666
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39493)
Chromosome
3
Position
58.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1086 was used as an overgo probe on plate 6 [well C9]

Plausible BAC Matches:   P257C07,   P255O20,   P034O02,   P332J07,   P288D21,   P239J12,   P174D19,   P062N06,   P157K18,   P070P03,   P190L06,   P322O07,   P122M13,   P223J13,   P198F24,   P031M05,   P277G02

 Overgo Sequences

A sequence
CTTGCTTGATGGGAATGGACATAG
B sequence
AGCTGAAAATCCCGCTCTATGTCC
AB sequence
CTTGCTTGATGGGAATGGACATAGAGCGGG
Marker sequence
GCTCTAAACTACATGTGTTAGAGGAGAGACGGGAGAAGAGTCTGCCGCCG
ACGTTGATTCCTCTAACATCATCAGCCGGCACTGTTTTCTGATCACAACT
CAAAGGTTGATTTTGGAGCATGATCAAGTATTAATTCGAGGGTTGATATG
GAAGGTGTGAACGGTAAAAAAGTGGGGCATTTATGTGAAAATATTAGCAG
CTTTGTTCGCCAATGTATATTTTCTATACTTAGTGTGGGTCCTGTTCCTA
GTCACATTGCTTTTATCATGGATGGAAACCGTAGATATTCTAAGAAACAG
AACTTGCTTGATGGGAATGGACATAGAGCGGGATTTTCAGCTCTTATCAA
TATGCTAAAATATTGTTACGAGCTTGGTGTAAAATATATAACAGTTTATG
CATTCAGCATTGATAACTTCAAGCGAAGGCCTGAAGAAGTTGTATCACTA
ATGAAACTGATGCAGGAAAAAATTGATGAATTAACAAAAGAGGAGAGCAT
TGTAAACCGCCTTGGTATTAGAATTTACTTTCAAGGAAACCTTAAACTTT
TGAGTGACCATGTCAGGTTAGCCGCCGAGAGGGCTATGGTAAAGACATCA
NGTAATTCANAAGCTATATTG
Genomic location of T1086  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1751 marker 1751
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)