SGN Marker T1093

SGN-M1758
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.07.01
Tomato EST read: TFBAU10THC
Arabidopsis best BAC match: AL078467.1
Arabidopsis position: 4.1400000
Arabidopsis identities: 0.809
Best GenBank protein hit: AAF82471.1
Evalue: 2e-119
Identities: 0.995
Description: light dependent NADH:protochlorophyllide oxidoreductase [Lycopersicon esculentum]
Comment: chlorophyll biosynthesis
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39495)
Chromosome
12
Position
54.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1093 was used as an overgo probe on plate 5 [well D2]

Plausible BAC Matches:   P090H01,   P218M01,   P099L08,   P180J10,   P033A13,   P281B12,   P017I24,   P294A09,   P225F05,   P201G12,   P180P04

 Overgo Sequences

A sequence
TAATCACTGGAGCGTCTTCAGGAC
B sequence
GCTGTAGCTAGTCCTAGTCCTGAA
AB sequence
TAATCACTGGAGCGTCTTCAGGACTAGGAC
Marker sequence
TCATTTTTTAAAATCTCCATCTTACAATTTTTTCAAAACAAAAATCATTT
TCCTAATATAATCATGGCTCTTCAAGCTGCTGCATTGCTTCCTTCTACTT
TCTCTATTCCAAAGGAGGGGAAAACTAGTGCATCTTTGAAGGATTCGAGT
CTCTTTGGAATTTCTCTCTCTGACCATGTTAAATCTGATTTTGGCTCTTC
ATTCAAAATCAAGAGCGGAAGAAAGTCATCCCTCGGAGCTATTAGAGCCG
AGACAATGGTTGCATCTCCCGGTGTAACGAGTACCCCTGTGACAGGAAAG
AAAACCTTAAGAAAAGGTTGTGTAGTAATCACTGGAGCGTCTTCAGGACT
AGGACTAGCTACAGCAAAAGCTCTGGCTGAGACAGGGAAATGGCATGTAA
TTATGGCATGTAGAGACTTTCTTAAAGCTGAAAGAGCAGCAAAATCAGCA
GGGATGCCTAAGGAGAATTATACAATAATGCATTTAGACCTTGCATCGCT
TGACAGCGTCAGACAATTTGTCGATAACTNTAGGAGATCAGGCAATCCTC
TTGATGTATTGGTTTGCAATGCAGCTGTTTATCAGCCTACCGCGAAAGAG
CCTTCGTTTACAGCTGAAGGATTTGAGCTTAGTGTTGGGACTAACCATCT
TGGTCATTTCCTTCTTTCGAGATTGTTGATTGATGATTTGAAGCAGTCTG
ATTACCCTTCAAAGAGACTCATCATTG
Genomic location of T1093  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1758 marker 1758
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)