SGN Marker solcap_snp_sl_1

SGN-M17588

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70654)
Chromosome
5
Position
48.68 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67125)
Chromosome
5
Position
56.64 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53919)
Chromosome
5
Position
59.04 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTGACTTGATTGAAGAATGGATTAAGAGAAATCCAAAAGCTTCCATTTGT
  
3' flanking region
CAAATGATGGAATTGAATCTTTCAGGAGAATTGCCAACTTTCAAGATTAT
SNP nucleotide
AG
SNPdb format
TTGACTTGATTGAAGAATGGATTAAGAGAAATCCAAAAGCTTCCATTTGT[A/G]
CAAATGATGGAATTGAATCTTTCAGGAGAATTGCCAACTTTCAAGATTAT
  
Genomic location of solcap_snp_sl_1  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17588 marker 17588
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)