SGN Marker solcap_snp_sl_100001

SGN-M17589

Synonyms  
1260_2_229
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 62872)
Chromosome
6
Position
45.47 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53920)
Chromosome
6
Position
37.75 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAGTCCATTTCTGTCATTCTTGCAAGCTCATTGGCCATGGCACCACCTTC
  
3' flanking region
CTAGCAGAGGAAATTGAAAAAGCTTCCCTTTTTGACTTCAACTTGACACT
SNP nucleotide
AG
SNPdb format
AAGTCCATTTCTGTCATTCTTGCAAGCTCATTGGCCATGGCACCACCTTC[A/G]
CTAGCAGAGGAAATTGAAAAAGCTTCCCTTTTTGACTTCAACTTGACACT
  
Genomic location of solcap_snp_sl_100001  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17589 marker 17589
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)