SGN Marker TG185

SGN-M176

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1060
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG185 image not available
Forward sequence
TGTGGTCCTTGTAAAGTGATTGCTCCAAAGTTTCAAGAGCTATCGAAGAAATATAACGATGTGGTCTTTCTGAAGCTGGACTGTAACCAG
GACAACAGGGTATGTATTCTTTAAACCACCTCACCTTGTAATGAAACAATACACGCTAGAATTGATCAATGTGATAATTTTTGGCAGCCA
CTAGCAAAGGAACTAGGCATAAAGGTGGTTCCAACGTTCAAGATTCTGAAGAACAATAAGATCGTTAAAGAAGTCACCGGAGCAAAACTT
GATGATTTAGTAGCAGCAATTGAGGGTGTGCGATCAAGTTAAATATTTCTCTTTTTTTTTCTATGACTTCTTCTGTTTAAATATGAAGCA
GATAATGTCTATGAATGTCGTAAATTAGTTCTAACTAAATTCAGTGTATAGCCGTGGATAATGAAGTCTCATTAGAGAAAATGGATGTGA
TGTACTTGTCTTGCCAATG
Reverse sequence
CCTCTGTTTGTCATCAAGCCATAGAACCGTTCGAGTAAGACCCGGGAAACAATATGCAGAGGAACTTGGCAAGTGTTTGTTTACCTTGGG
CTTATGATATTTTGCAGTATTTCAGTTTCAGTGAGTATGTTTGCATTGACTGGTAGTGTGATGGAAATTGGAATAGACGATTCTGGCTAA
AACTCATTAGGAGAGTTTAGTGTTTAATCTGAGGTATTCTTTGGCATTTTATTGTGGGATTCTAGCTTACTCATTTTTCCTTTTTCAGTT
TGACATATTTATGTGAGGTTTGTACCTCGATAACAATCTCATCGCATTATGATAATGATTGTATGCAGTTTTGATTATTTAGCCCCGCTA
TTTCATGTGAAATAGTTTCAATTTACTTGACTCAACATAACTTGGAACTACTAGAGTTCTCATTTTCCTCACATATGTTATGTTAGAATC
AATGTATATCGATTATAAGATGTGA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1500351.4e-4799 (21.1% of RFLP seq)+
SGN-U1500357.8e-74139 (29.6% of RFLP seq)+
SGN-U1500352e-74144 (30.7% of RFLP seq)+
SGN-U166957357 (75.2% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53523)
Chromosome
5
Position
91.68 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53205)
Chromosome
5
Position
47.40 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43845)
Chromosome
5
Position
94.30 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43590)
Chromosome
5
Position
88.30 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43305)
Chromosome
5
Position
86.60 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42415)
Chromosome
5
Position
59.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40844)
Chromosome
5
Position
99.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39932)
Chromosome
5
Position
119.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8443)
Chromosome
5
Position
59.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8442)
Chromosome
5
Position
96.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8448)
Chromosome
5
Position
55.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8447)
Chromosome
5
Position
107.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG185 was used as an overgo probe on plate 3 [well H11]

Plausible BAC Matches:   P106J01,   P251J13,   P153B11

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CGATGTGGTCTTTCTGAAGCTGGA
B sequence
GTTGTCCTGGTTACAGTCCAGCTT
AB sequence
CGATGTGGTCTTTCTGAAGCTGGACTGTAA
Marker sequence
TGTGGTCCTTGTAAAGTGATTGCTCCAAAGTTTCAAGAGCTATCGAAGAA
ATATAACGATGTGGTCTTTCTGAAGCTGGACTGTAACCAGGACAACAGGG
TATGTATTCTTTAAACCACCTCACCTTGTAATGAAACAATACACGCTAGA
ATTGATCAATGTGATAATTTTTGGCAGCCACTAGCAAAGGAACTAGGCAT
AAAGGTGGTTCCAACGTTCAAGATTCTGAAGAACAATAAGATCGTTAAAG
AAGTCACCGGAGCAAAACTTGATGATTTAGTAGCAGCAATTGAGGGTGTG
CGATCAAGTTAAATATTTCTCTTTTTTTTTCTATGACTTCTTCTGTTTAA
ATATGAAGCAGATAATGTCTATGAATGTCGTAAATTAGTTCTAACTAAAT
TCAGTGTATAGCCGTGGATAATGAAGTCTCATTAGAGAAAATGGATGTGA
TGTACTTGTCTTGCCAATG
Genomic location of TG185  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D176 marker 176
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)