SGN Marker T1095

SGN-M1760
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBAU19THC
Arabidopsis best BAC match: AL132968.1
Arabidopsis position: 3.1150900
Arabidopsis identities: 0.795
Best GenBank protein hit: CAB63153.1
Evalue: 3.7e-74
Identities: 0.728
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39497)
Chromosome
9
Position
50.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1095 was used as an overgo probe on plate 6 [well D4]

Plausible BAC Matches:   P156K17,   P336O01,   P122N18,   P253J24,   P317H23,   P223I17,   P069G24,   P223J11,   P191E09,   P165P13,   P130A01,   P177F13,   P283C01,   P212H19,   P079D18,   P305C04,   P041H16,   P310K03,   P116J01,   P233D08,   P012C18,   P109C17,   P078I09

 Overgo Sequences

A sequence
ATCCCAAGAATCAGCTCCACAATC
B sequence
TTGTGGCTTTGGTGAAGATTGTGG
AB sequence
ATCCCAAGAATCAGCTCCACAATCTTCACC
Marker sequence
TGGATTCTTCATCCCCCATTACTGTTCAAAAAGCTCTAAAATCCCAAGAA
TCAGCTCCACAATCTTCACCAAAGCCACAATCTTTGAAGAAAAGCTTTGT
CACTTCTCTAATGGAAGCAACTACTTTACGCACCCCATCTTTTAAAGAAG
ACTCTTACTTCACTTCTCACATTAAACCCTCTGAAAAGAAAGCATTACAA
GAATTGAAAGACAAGCTTCAATCTTCTTCTTCTTCTTGTTCCATGTGGGG
TATTCCACTTTTAGGTGGAGATGAAAAGGCTGATGTCATTCTGTTGAAAT
TCCTCAGAGCAAGGGATTTTAAGGTTTCAGATTCACTTCATATGTTAGAA
AAGTGTGTTTCTTGGAGAAAAGAGTTTGGTGCTGACACCATTTTGGAAGA
AGATTTTTCAGGATTTAAAGAACTTGAAGGAGTTGTTGCTTATATGAATG
GTTATGATAGAGATGGACACCCTGTTTGTTACAATGCTTATGGGGTTTTT
AAGGATAAAGAAATGTATGAAAAAATCTTTGGGGATGAAGAAAAATTGAA
AAAATTCTTGAGATGGAGAGTTCAAGTTCTTGAAAGAGGAATTGAACAAC
TACATTTCAAGCCTGGTGGAATTAATTCCATTATTCANGTAACTGATCTC
AAAGATAT
Genomic location of T1095  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1760 marker 1760
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)