Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

SGN Marker solcap_snp_sl_100016

SGN-M17604

Synonyms  
241_2R_235
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53935)
Chromosome
2
Position
37.38 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAGAGGCCTGGAGTGGATGGATACATTTATGTGAGATCATTGTATTTTTT
  
3' flanking region
ATCCTCTTTAATTTACTGTTGTCCTAGAGGGATGCACATATTTGCAGCCT
SNP nucleotide
TG
SNPdb format
GAGAGGCCTGGAGTGGATGGATACATTTATGTGAGATCATTGTATTTTTT[T/G]
ATCCTCTTTAATTTACTGTTGTCCTAGAGGGATGCACATATTTGCAGCCT
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_100016  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17604 marker 17604
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)