SGN Marker solcap_snp_sl_100020

SGN-M17608

Synonyms  
2534_1F_288
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53939)
Chromosome
9
Position
17.00 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTGTGATGAGCTAGTGCAACATGGAGCCTCTGTTGGAGAAACTCCTGCAG
  
3' flanking region
AGTAATCAAGAAATGCAAGTATACAATTGCAATGTTGTCTGATCCAGCTG
SNP nucleotide
AC
SNPdb format
GTGTGATGAGCTAGTGCAACATGGAGCCTCTGTTGGAGAAACTCCTGCAG[A/C]
AGTAATCAAGAAATGCAAGTATACAATTGCAATGTTGTCTGATCCAGCTG
  
Genomic location of solcap_snp_sl_100020  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17608 marker 17608
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)