SGN Marker T1096

SGN-M1761
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.11.01
Tomato EST read: TFBAU20THC
Arabidopsis best BAC match: AB011477.1
Arabidopsis position: 5.1200000
Arabidopsis identities: 0.903
Best GenBank protein hit: BAB11343.1
Evalue: 3.7e-91
Identities: 0.793
Description: cytochrome c1 precursor [Arabidopsis thaliana]
Comment: "mitochondrial electron transport, Complex III"
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49389)
Chromosome
2
Position
49.18 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47324)
Chromosome
2
Position
155.56 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39498)
Chromosome
2
Position
141.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1096 was used as an overgo probe on plate 11 [well C7]

Plausible BAC Matches:   P170O04,   P258K11,   P076B16,   P194L19,   P025I09,   P199O03,   P053L01,   P293E01,   P106B23,   P326H02,   P330K01

 Overgo Sequences

A sequence
TTGCGACAGTAGCATCTGCTGATG
B sequence
AATCCGTGTTCAGCCTCATCAGCA
AB sequence
TTGCGACAGTAGCATCTGCTGATGAGGCTG
Marker sequence
GGTTTTCCGGATCTCTCAGGCGCTGTTTGTCCTATCGCCGTCGATCAACC
CTCTCTACGGTCCTTTTCCGAGGGCGTGACTAACAATGTTGGGAGGTAGA
GCAGTCCATCGCTTACTAGGCAGGAAATTTCAATCTGAATCCACGGCATC
TCCAATTTTATCATCCTTTGTTTCCAAAAAAGCTCAAGAAGAATTTGGTT
CTTTTGGCATGAAGTCCTTCAGAACATTAGCACTCATTGGAGCGGGTGTA
TCTGGACTTCTAGGTTTTGCGACAGTAGCATCTGCTGATGAGGCTGAACA
CGGATTGGAATGCCCAAGCTATCCTTGGCCTCATGCAGGCATTCTTAGTT
CATACGATCATGCTTCGATTCGTCGTGGTCACCAGGTTTATCAACAAGTA
TGTGCATCTTGTCATTCAATGTCACTTGTTTCATATCGTGACTTGGTCGG
GGTGGCATATACAGAGGAAGAAGTAAAGGCTATGGCAGCTGAGATTGAGG
TGGCGGATGGGCCTAATGATGAGGGTGAAATGTTTACCCGTCCTGGTAAA
CTGAGTGATCGTTTTCCTCAGCCATATCCAAATGAAGCAGCTGCTAGATT
TGCTAATGGGGGAGCCTACCCTNCAGATTTAAGTCTTATTACAAAAGCAC
GCCATAATGGTCAAAACTATGTGTTTGCTCTTCTTACTGGCTATCG
Genomic location of T1096  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1761 marker 1761
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)