SGN Marker solcap_snp_sl_100026

SGN-M17614

Synonyms  
2875_4_1050
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 62882)
Chromosome
2
Position
55.47 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53945)
Chromosome
2
Position
34.91 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTGCTCATTTTTGCAAATAGAATATTTTCCCTCCAATTCCTTTCAACAAT
  
3' flanking region
TGTATGACGTTAGTGTTTTGGTTATTGTGGCACTACATCATGCACTAATC
SNP nucleotide
AT
SNPdb format
GTGCTCATTTTTGCAAATAGAATATTTTCCCTCCAATTCCTTTCAACAAT[A/T]
TGTATGACGTTAGTGTTTTGGTTATTGTGGCACTACATCATGCACTAATC
  
Genomic location of solcap_snp_sl_100026  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17614 marker 17614
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)