SGN Marker solcap_snp_sl_100027

SGN-M17615

Synonyms  
2875_4_240
2875_4_240_2875_4b_77_b
2875_4b_77_b
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53946)
Chromosome
2
Position
34.91 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATTGATTTGCGCTTTTGAATAAGTAATGTAAATCGTATGAAAAATTCTG
  
3' flanking region
GGGGCTGTTATTGTACACAAGAAGCACATTCAAACCCTGTCAACTTAATG
SNP nucleotide
AC
SNPdb format
AATTGATTTGCGCTTTTGAATAAGTAATGTAAATCGTATGAAAAATTCTG[A/C]
GGGGCTGTTATTGTACACAAGAAGCACATTCAAACCCTGTCAACTTAATG
  
Genomic location of solcap_snp_sl_100027  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17615 marker 17615
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)