SGN Marker solcap_snp_sl_100029

SGN-M17617

Synonyms  
2875_4_368
2875_4b_205_b
2875_4b_205_b_2875_4_368
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66386)
Chromosome
2
Position
41.42 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53948)
Chromosome
2
Position
34.91 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTAATGCATATNATACAAACAGTTAACAACAACCCCCTCAAGTACTTAAC
  
3' flanking region
CAGCTTTCCACCAAGTTTAAAAGAGGAGATAAGAAGTGGTGTCTTACTGT
SNP nucleotide
AT
SNPdb format
TTAATGCATATNATACAAACAGTTAACAACAACCCCCTCAAGTACTTAAC[A/T]
CAGCTTTCCACCAAGTTTAAAAGAGGAGATAAGAAGTGGTGTCTTACTGT
  
Genomic location of solcap_snp_sl_100029  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17617 marker 17617
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)