SGN Marker solcap_snp_sl_100030

SGN-M17618

Synonyms  
2875_4_480
2875_4b_317_b
2875_4b_317_b_2875_4_480
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53949)
Chromosome
2
Position
34.91 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTGATGTGATGTTAGAAATTGCTGCAATATCTCGGTGAAGCCTCTTTTTT
  
3' flanking region
AAATTGGTTAGAATGTTCAAATTTGAACAATATTTGTCCCTCTTGGCCAA
SNP nucleotide
AT
SNPdb format
TTGATGTGATGTTAGAAATTGCTGCAATATCTCGGTGAAGCCTCTTTTTT[A/T]
AAATTGGTTAGAATGTTCAAATTTGAACAATATTTGTCCCTCTTGGCCAA
  
Genomic location of solcap_snp_sl_100030  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17618 marker 17618
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)