SGN Marker T1098

SGN-M1762
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBAU38THC
Arabidopsis best BAC match: AC002333.2
Arabidopsis position: 2.2370000
Arabidopsis identities: 0.703
Best GenBank protein hit: AAB64028.1
Evalue: 4.9e-18
Identities: 0.767
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39499)
Chromosome
6
Position
30.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1098 was used as an overgo probe on plate 4 [well D9]

Plausible BAC Matches:   P217N24,   P180O15,   P113M01

 Overgo Sequences

A sequence
GGTTAGTTCCTTCTGAGAAGATGG
B sequence
TATCCTGGAAGTCCAGCCATCTTC
AB sequence
GGTTAGTTCCTTCTGAGAAGATGGCTGGAC
Marker sequence
GCAGAATACAAAAGTCTTAGGTTAGTTCCTTCTGAGAAGATGGCTGGACT
TCCAGGATACAGCGCCCTTGCTCCCAAGACTAAGAATCTGGTTATGGCTG
GAGGTTTGACAGGATTTGTTTTTGGTGTGTACTACTACACTATGAGAGCT
GTTGGAGGCTCAGATGAACTTCAAGTAGCCATTGATAAGTTTGAAGATGC
AAAACGCAGCAGTGACGCTGAAGCAAGTTTGGCACCCAAGCAATAATTGT
GTCCAATATGAAGGTGACACTGCAATTTGGAAAGAAGTACTGGATGATTT
TGAAGGAGTAGAACCAGACTGAATAACTAAAACTGTTTCTCATGCTTTGC
GAATACACACACTTAGCTGTAAAGATATCAAGATATTGCATCCTTTTTTA
AGCTTTTATGTTGAGATAAATTTTCTTCTTTTTTGAATTTCAATGTCTAC
AGACTATACAGTCATCCTGTTTATTTTAGGTTTTACAGACTCTTCATTTA
GTATTCCTGTTGAGTTTGATCATCGGGCTGATAATGAGAGAATATAAAAT
CTGGTACAAGTATAAAGTGACGAAC
Genomic location of T1098  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1762 marker 1762
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)