SGN Marker solcap_snp_sl_100036

SGN-M17624

Synonyms  
3081_1_53
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 62885)
Chromosome
7
Position
55.37 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53955)
Chromosome
7
Position
60.33 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGAGCTCAGTCTCCAAAGATCAGGCAAGTTATATTAGAAGATCAAAGTTA
  
3' flanking region
GTTGAATGTTTTGTTATTACAGTAATTGAGATATATCGCAATGTTCATTA
SNP nucleotide
AC
SNPdb format
AGAGCTCAGTCTCCAAAGATCAGGCAAGTTATATTAGAAGATCAAAGTTA[A/C]
GTTGAATGTTTTGTTATTACAGTAATTGAGATATATCGCAATGTTCATTA
  
Genomic location of solcap_snp_sl_100036  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17624 marker 17624
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)