SGN Marker solcap_snp_sl_100039

SGN-M17627

Synonyms  
3155_3_479
3155_3_488_b
3155_3_488_b_3155_3_479
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70070)
Chromosome
5
Position
49.49 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66388)
Chromosome
5
Position
56.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 62886)
Chromosome
5
Position
69.55 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53958)
Chromosome
5
Position
59.43 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTCTGTTAAATGGCTTTCCAAGACCAGTTAAAACTGGTTTGTGTTTCGC
  
3' flanking region
AAGCATGTTGTGTTATTTATGTTTCTTAAGGTGGNAAAGGATTCTGGATT
SNP nucleotide
AG
SNPdb format
GTTCTGTTAAATGGCTTTCCAAGACCAGTTAAAACTGGTTTGTGTTTCGC[A/G]
AAGCATGTTGTGTTATTTATGTTTCTTAAGGTGGNAAAGGATTCTGGATT
  
Genomic location of solcap_snp_sl_100039  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17627 marker 17627
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)