SGN Marker solcap_snp_sl_100040

SGN-M17628

Synonyms  
3155_3_514
3155_3_523_b
3155_3_523_b_3155_3_514
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70071)
Chromosome
5
Position
49.49 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66389)
Chromosome
5
Position
56.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 62887)
Chromosome
5
Position
69.55 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53959)
Chromosome
5
Position
59.43 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGGTTTGTGTTTCGCNAAGCATGTTGTGTTATTTATGTTTCTTAAGGTGG
  
3' flanking region
AAAGGATTCTGGATTACATTTCAGGTTTTGCTTTCAATTTGCTCACTTTT
SNP nucleotide
AG
SNPdb format
TGGTTTGTGTTTCGCNAAGCATGTTGTGTTATTTATGTTTCTTAAGGTGG[A/G]
AAAGGATTCTGGATTACATTTCAGGTTTTGCTTTCAATTTGCTCACTTTT
  
Genomic location of solcap_snp_sl_100040  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17628 marker 17628
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)