SGN Marker solcap_snp_sl_100041

SGN-M17629

Synonyms  
3155_3_583
3155_3_592_b
3155_3_592_b_3155_3_583
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70072)
Chromosome
5
Position
49.49 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53960)
Chromosome
5
Position
59.43 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTCAGGTTTTGCTTTCAATTTGCTCACTTTTGACGGACCCAAACCCTGA
  
3' flanking region
GACCCCTTGGTTCCTGAGATTGCTCACATGTACAAGACTGACAAGTCCAA
SNP nucleotide
TC
SNPdb format
TTTCAGGTTTTGCTTTCAATTTGCTCACTTTTGACGGACCCAAACCCTGA[T/C]
GACCCCTTGGTTCCTGAGATTGCTCACATGTACAAGACTGACAAGTCCAA
  
Genomic location of solcap_snp_sl_100041  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17629 marker 17629
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)