SGN Marker solcap_snp_sl_100042

SGN-M17630

Synonyms  
3197_2_51
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70073)
Chromosome
9
Position
69.65 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 62888)
Chromosome
9
Position
137.33 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53961)
Chromosome
9
Position
66.49 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCAGTAATTTGTCATTCCCCTTTGTTTGTCATGTTATTCACTGTTTAAAT
  
3' flanking region
TTGTGATGCACTACAACTTAATACGTCTGAATTGTCAATCCATTCGGTTT
SNP nucleotide
CG
SNPdb format
TCAGTAATTTGTCATTCCCCTTTGTTTGTCATGTTATTCACTGTTTAAAT[C/G]
TTGTGATGCACTACAACTTAATACGTCTGAATTGTCAATCCATTCGGTTT
  
Genomic location of solcap_snp_sl_100042  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17630 marker 17630
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)