SGN Marker solcap_snp_sl_100044

SGN-M17632

Synonyms  
3332_3_170
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70076)
Chromosome
7
Position
36.17 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53963)
Chromosome
7
Position
54.81 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTACTAATAAAGCTGCTGCTGCTGCAACATCGTAATCCGTGCTCATAAGTGGAGTTTCGAGAAGGTGATATATATATACTAGTTTTCGAAACGTGCT
  
3' flanking region
GC
SNP nucleotide
TC
SNPdb format
GTACTAATAAAGCTGCTGCTGCTGCAACATCGTAATCCGTGCTCATAAGTGGAGTTTCGAGAAGGTGATATATATATACTAGTTTTCGAAACGTGCT[T/C]
GC
  
Genomic location of solcap_snp_sl_100044  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17632 marker 17632
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)