SGN Marker solcap_snp_sl_100046

SGN-M17634

Synonyms  
437_2_322
437_2_335_b
437_2_335_b_437_2_322
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66391)
Chromosome
9
Position
45.24 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 62890)
Chromosome
9
Position
64.62 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53965)
Chromosome
9
Position
54.72 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACAACTACAACAAAACCTGTAAAATTAGAAAAGGCTAAAATTTTGAATAA
  
3' flanking region
GTTTCCTCTTGGTATACACACAATCAGCCTGCGTATCTTTAATATGTTAT
SNP nucleotide
TG
SNPdb format
ACAACTACAACAAAACCTGTAAAATTAGAAAAGGCTAAAATTTTGAATAA[T/G]
GTTTCCTCTTGGTATACACACAATCAGCCTGCGTATCTTTAATATGTTAT
  
Genomic location of solcap_snp_sl_100046  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17634 marker 17634
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)