Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker solcap_snp_sl_100047

SGN-M17635

Synonyms  
437_2_37
437_2_52_b
437_2_52_b_437_2_37
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53966)
Chromosome
9
Position
54.72 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTAAGAATGTCCTTGATGCGTTCTTCTTAGGTAAAGCTCTGGCNGAAGC
  
3' flanking region
GTTACTGAGCGCATAGAGTCTACAGTAGGGGAGTTCCTAAGTACAGTTGG
SNP nucleotide
AT
SNPdb format
AGTAAGAATGTCCTTGATGCGTTCTTCTTAGGTAAAGCTCTGGCNGAAGC[A/T]
GTTACTGAGCGCATAGAGTCTACAGTAGGGGAGTTCCTAAGTACAGTTGG
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_100047  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17635 marker 17635
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)