Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker solcap_snp_sl_100048

SGN-M17636

Synonyms  
437_2_578
437_2_591_b
437_2_591_b_437_2_578
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53967)
Chromosome
9
Position
54.71 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTGAAAGAGCCAAACAAGCCAAAGAGAAAGCAGCACGTGAGACGATGGAA
  
3' flanking region
CACAAGGACTTATTTCCAACTCATATGAAGCAGACACATCGACAGCAACT
SNP nucleotide
AT
SNPdb format
TTGAAAGAGCCAAACAAGCCAAAGAGAAAGCAGCACGTGAGACGATGGAA[A/T]
CACAAGGACTTATTTCCAACTCATATGAAGCAGACACATCGACAGCAACT
  
Genomic location of solcap_snp_sl_100048  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17636 marker 17636
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)