SGN Marker solcap_snp_sl_100050

SGN-M17638

Synonyms  
Bcyc_868
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70080)
Chromosome
6
Position
54.96 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66395)
Chromosome
6
Position
63.42 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 62894)
Chromosome
6
Position
73.82 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53969)
Chromosome
6
Position
42.29 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGAATAATGCTAAAGAACCAACATTCTTGTATGCAATGCCATTTGATAGA
  
3' flanking region
ATTTGGTTTTCTTGGAAGAGACTTCTTTGGTGAGTCGTCCTGTTTTATCG
SNP nucleotide
AG
SNPdb format
TGAATAATGCTAAAGAACCAACATTCTTGTATGCAATGCCATTTGATAGA[A/G]
ATTTGGTTTTCTTGGAAGAGACTTCTTTGGTGAGTCGTCCTGTTTTATCG
  
Genomic location of solcap_snp_sl_100050  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17638 marker 17638
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)