SGN Marker T1105

SGN-M1765
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.06.04
Tomato EST read: None
Arabidopsis best BAC match: AB017070.1
Arabidopsis position: 5.1390000
Arabidopsis identities: 0.797
Best GenBank protein hit: BAB10591.1
Evalue: 3.2e-69
Identities: 0.715
Description: enoyl CoA hydratase-like protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39500)
Chromosome
2
Position
0.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1105 was used as an overgo probe on plate 1 [well E10]

Plausible BAC Matches:   P299J08,   P111J02

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TGAATTCCCCAAAGCCATCTCCTC
B sequence
GGGGTTTTGATCGAGTGAGGAGAT
AB sequence
TGAATTCCCCAAAGCCATCTCCTCACTCGA
Marker sequence
GCAAATAATGGAGGAATACAAATCACTGAAAATCATTCAAAAATCTCCAA
ATTCTCTTGTTTATTACCTGTATCTCAACCGACCCACACACCTCAACGCT
CTCTCACAAGATTTCTTCACTGAATTCCCCAAAGCCATCTCCTCACTCGA
TCAAAACCCCGATGTCGCCGTTATCATCCTCGCTGGCTCCGGCAAGCACT
TCTGTTCCGGCATCGACCTCCATACCCTAGGTGATGTCTTCAAAGAAACC
GACGCCGTTGATTGTGGCCGTAAAGTTGAGAGACTCCGGCGACATATCAA
GTTTCTTCAGGAGGCTATTACTGCCTTAGAGTGTTGCCGTAAACCGGTGA
TTGCTGCTGTCCATGGCGCATGTATCGGTGGTGCGATTGATATCATTACT
GCCTGTGATATTAGGTATTGTTCTACTGATGCTTTTTTCTCAGTGAAAGA
GGTGGATTTAGCTATTACGGCTGATCTCGGGACACTTCAGAGGCTTCCCA
GTATTGTTGGGTTTGGAAATGCTATGGAGTTGGCTTTAACTGG
Genomic location of T1105  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1765 marker 1765
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)