Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_100069

SGN-M17656

Synonyms  
C2_At1g73180_83_b
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53987)
Chromosome
8
Position
3.58 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTGAGCTGGAACTCTGGTTCTACAGGGCTCCTAGTGGTGGTCCAATCAGA
  
3' flanking region
GTTGATAAAANAAACCAGAGTTANTATGGAGAATCAAAGTTGAACTACTT
SNP nucleotide
TC
SNPdb format
CTGAGCTGGAACTCTGGTTCTACAGGGCTCCTAGTGGTGGTCCAATCAGA[T/C]
GTTGATAAAANAAACCAGAGTTANTATGGAGAATCAAAGTTGAACTACTT
  
Genomic location of solcap_snp_sl_100069  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17656 marker 17656
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)