SGN Marker solcap_snp_sl_100075

SGN-M17662

Synonyms  
Cd2_3001
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53993)
Chromosome
1
Position
76.98 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TATACGCGCCAGTTGATATTCCGGCAATGCACGTGGTGATGAACGGTGGA
  
3' flanking region
ATTCGGCTTACGTGGCTTTGCTTCCTTCGGGATTCTCAATTGTACCCGAC
SNP nucleotide
AG
SNPdb format
TATACGCGCCAGTTGATATTCCGGCAATGCACGTGGTGATGAACGGTGGA[A/G]
ATTCGGCTTACGTGGCTTTGCTTCCTTCGGGATTCTCAATTGTACCCGAC
  
Genomic location of solcap_snp_sl_100075  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17662 marker 17662
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)