SGN Marker solcap_snp_sl_100081

SGN-M17668

Synonyms  
CL001269-0981
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 53999)
Chromosome
5
Position
0.69 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGTGGTGTTGGCATCAGAGGAGATTCAATGCTCTTGCCATTAGGAGGTTGAAGGAGATTCAGTGCTATAGAGGAGTAAGGCACATCCAAGGATTGCCTTG
  
3' flanking region
AGAGGACAA
SNP nucleotide
TC
SNPdb format
TGTGGTGTTGGCATCAGAGGAGATTCAATGCTCTTGCCATTAGGAGGTTGAAGGAGATTCAGTGCTATAGAGGAGTAAGGCACATCCAAGGATTGCCTTG[T/C]
AGAGGACAA
  
Genomic location of solcap_snp_sl_100081  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17668 marker 17668
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)