SGN Marker solcap_snp_sl_100083

SGN-M17670

Synonyms  
CL001745-0493
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 54001)
Chromosome
9
Position
58.94 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCTTTTCTTTTTTTCATTTTGTATTGCTCATACAAGGTTGATTATTATGGCACTCCAGTCAGCTTGAAAAGCATAGCACAAATTAGCACTCCTGATGCAA
  
3' flanking region
TTCTATCTTGGTGCAGCCGTATGACAAATCCAGGTTNAACTTCTGAAACATTTGAATAAANGAAAGAAAATCAGGTCGGACTG
SNP nucleotide
CG
SNPdb format
GCTTTTCTTTTTTTCATTTTGTATTGCTCATACAAGGTTGATTATTATGGCACTCCAGTCAGCTTGAAAAGCATAGCACAAATTAGCACTCCTGATGCAA[C/G]
TTCTATCTTGGTGCAGCCGTATGACAAATCCAGGTTNAACTTCTGAAACATTTGAATAAANGAAAGAAAATCAGGTCGGACTG
  
Genomic location of solcap_snp_sl_100083  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D17670 marker 17670
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)