SGN Marker T1109

SGN-M1768
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TFBBA20TH
Arabidopsis best BAC match: AL031394.1
Arabidopsis position: 4.1720000
Arabidopsis identities: 0.727
Best GenBank protein hit: CAB80080.1
Evalue: 7.5e-38
Identities: 0.552
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49390)
Chromosome
1
Position
85.75 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47325)
Chromosome
1
Position
128.45 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39503)
Chromosome
1
Position
140.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1109 was used as an overgo probe on plate 9 [well H6]

Plausible BAC Matches:   P245N21,   P279M01,   P032I24,   P010D01

 Overgo Sequences

A sequence
GATCAGCCTCACTCTTACTCAAGC
B sequence
TGGCTGACGATTTCGTGCTTGAGT
AB sequence
GATCAGCCTCACTCTTACTCAAGCACGAAA
Marker sequence
TGGAAGGGTCACCTGTCATTTACTTTCACTATAGAGGAAGATGAGAACAA
AAGCAATTTCTCTGGCAGTGGACAATCTCCCCCAAATAAAAAGGCTAGGC
TTCAAGGTCAACGTAGCTTGGATCATGTGATGGTTGATCTTGCAAAGTTC
ATGGGCAAGGGGAAAATACCTATGAAGGTCCTTAAAGATATGGGAGAGTT
GATCAGCCTCACTCTTACTCAAGCACGAAATCGTCAGCCATTATCAAAGT
CAACCACCTTTAACCGCATTGAGATTTCAACATCTCCAGACCCACTAAAT
GGATTATATATTGGTGCTCATGGGCTGTACACTTCAGAAGTCATTCACTT
TATACGAAGATTTGGTCATTGGAAAGAAGACGGTAGCCCTAAAGAGTCTT
CACGCTTAGAATTTTACGAGTATGTTGAAGCGGTAAAATTAACTGGAGAC
TCTTATGTGCCAGCTG
Genomic location of T1109  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1768 marker 1768
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)